Review





Similar Products

96
ATCC template dna
Template Dna, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/templates/Staphylococcus+aureus+subsp%2E+aureus+Rosenbach/pm42243900-91-8-19
Average 96 stars, based on 1 article reviews
template dna - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

86
Pacific Biosciences smrtbell express template prep kit 2 0
Smrtbell Express Template Prep Kit 2 0, supplied by Pacific Biosciences, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/templates/0+3+kit+prep+smrtbell/pm42321367-55-18-24
Average 86 stars, based on 1 article reviews
smrtbell express template prep kit 2 0 - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Sangon Biotech spike in template f
Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
Spike In Template F, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/templates/f+in+spike+template/pmc13142104-80-0-10
Average 86 stars, based on 1 article reviews
spike in template f - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Twist Bioscience hdr dna template sequence
Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
Hdr Dna Template Sequence, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/templates/dna+templates/pmc13265900-103-0-5
Average 86 stars, based on 1 article reviews
hdr dna template sequence - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Twist Bioscience dna template
Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
Dna Template, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/templates/dna+templates/pmc13265900-441-1-10
Average 86 stars, based on 1 article reviews
dna template - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Sangon Biotech spike in template r
Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
Spike In Template R, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/templates/f+in+spike+template/pmc13142104-81-0-10
Average 86 stars, based on 1 article reviews
spike in template r - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Pacific Biosciences smrtbell template prep kit
Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
Smrtbell Template Prep Kit, supplied by Pacific Biosciences, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/templates/0+3+kit+prep+smrtbell/pm42304218-94-9-13
Average 86 stars, based on 1 article reviews
smrtbell template prep kit - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Solexa template dna polynucleotides
Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
Template Dna Polynucleotides, supplied by Solexa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/templates/dna+polynucleotides+template/us12655481-206-0-21
Average 86 stars, based on 1 article reviews
template dna polynucleotides - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

94
OriGene mrna quantification
Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
Mrna Quantification, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/templates/MRAS+Human+qPCR+Template+Standard/pm42263107-200-2-7
Average 94 stars, based on 1 article reviews
mrna quantification - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

86
Pacific Biosciences smrtbell template prep kit 1 0
Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
Smrtbell Template Prep Kit 1 0, supplied by Pacific Biosciences, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/templates/0+3+kit+prep+smrtbell/pm42274213-394-14-20
Average 86 stars, based on 1 article reviews
smrtbell template prep kit 1 0 - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

Image Search Results


Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel shows spike-in RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.

Journal: STAR Protocols

Article Title: Protocol to produce and apply barcoded rabies virus for single-neuron input mapping in mice

doi: 10.1016/j.xpro.2026.104537

Figure Lengend Snippet: Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel shows spike-in RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.

Article Snippet: Spike-In template F , TAATACGACTCACTATAGGGAGTGAC AATGAAACCTACGTAGTGCAAAGAGA AGTGGCAGTTGCCAAATACAGCAACC TTGGTGGTGGCATGGACGAGCTGTAC AAGTAAGGTACCGGCCAT , Sangon Biotech.

Techniques: Amplification, Purification, Control, In Vitro, Reverse Transcription

Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel shows spike-in RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.

Journal: STAR Protocols

Article Title: Protocol to produce and apply barcoded rabies virus for single-neuron input mapping in mice

doi: 10.1016/j.xpro.2026.104537

Figure Lengend Snippet: Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel shows spike-in RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.

Article Snippet: Spike-In template R , TTTTTTTCTCGACTGAAATGCTTAGAT GACCCAGCCCTCAATAGGGCCGCCT CGGCCNNNTGNNNACNNNATNNNG CNNNTGNNNACNNNGGCCGTAATG GCCGGTACCTTA , Sangon Biotech.

Techniques: Amplification, Purification, Control, In Vitro, Reverse Transcription